Skip to main content

Table 1 PCR primer sequence for H. pylori virulence genes

From: Anti-Helicobacter pylori activity of acomplex mixture of Lactobacillus paracasei HP7 including the extract of Perilla frutescens var. acuta and Glycyrrhiza glabra

Gene name Sequence Tm (° C) Reference
alpA F: AAACCGCTCTGTGGATATGG 55.0 NZ_CP009259.1
R: GAACTGGAAGTGCGTGTTATTG 45.6
cagA F: TCACTCTTGGCGATATGGAAAT 57.5
R: ACACAGAAGACAGAGCGTTATT 57.7
flaA F: GCTAAGAGCATCAATGTGGTTTC 58.3
R: CGGTAACATCGCGCAAATTC 58.5
ureA F: AGTGGGTATTGAAGCGATGTT 57.6
R: AAGAACAACTCACCAGGAACTAA 57.6