Skip to main content

Advertisement

Table 1 Primers used for quantitative RT-PCR

From: Comparative study of liver injury induced by high-fat methionine- and choline-deficient diet in ICR mice originating from three different sources

Genes Primer Sequences
TNF-α F: GGCCTCTCTACCTTGTTGCC R: CAGCCTGGTCACCAAATCAG
IL-6 F: TTGCCTTCTTGGGACTGATG R: CCACGATTTCCCAGAGAACA
IL-1β F: TTCACCATGGAATCCGTGTC R: GTCTTGGCCGAGGACTAAGG
α-SMA F: GCACCCAGCATGAAGATCAAG R: TCTGCTGGAAGGTAGACAGCGAAG
TGFβ1 F: GCCCTGGATACCAACTATTGC R: TGTTGGACAGCTGCTCCACCT
Col1a1 F: ACCTGTGTGTTCCCTACTCA R: GACTGTTGCCTTCGCCTCTG
GAPDH F: GTTGTCTCCTGCGACTTCA R: GGTGGTCCAGGGTTTCTTA